Music from the Genome: Cloud Atlas as Biological Symphony

March 15, 2015 § 2 Comments

Describing his composition of Cloud Atlas Sextet to his friend Sixsmith, Robert Frobisher writes, “Boundaries between noise and sound are conventions…. All boundaries are conventions…. One may transcend any convention” (Mitchell 460). It is this excerpted sentence that I identify as crystalizing the agenda of David Mitchell’s fantastic 2004 epic Cloud Atlas. By “crystalizing,” I mean that this description of musical composition allows for one to connect the six narratives of Cloud Atlas beyond the characters’ reading of one another’s life stories. The six seemingly separate narratives are, in fact, radical examples of this transcendence of formal conventions. What I would like to briefly examine here is the musical nature of this novel, but not music in the conventional way of thinking about it, but rather in considering genetic code as music. In what way is Cloud Atlas exhibiting a musical composition in its novelistic formation, and in the connections between the narratives?

Michael Zev Gordon’s 2010 musical composition “Allele,” collaboratively conceived of by the project Music from the Genome, has been an unexpected but wonderful discovery during the writing of this blog post. Music from the Genome project is an excellent example of interdisciplinarity in that it marries genetic science with music and poetry; the project not only examined the genetic characteristics of choral singers, but also translated DNA coding into music accompanied by lyric written by poet Ruth Padel. As Music from the Genome’s website explains, “the results of DNA analysis from 40 members of the New London Chamber Choir were used to create a major new choral work, ‘Allele’…. Each singer’s musical part was created using the results of their own personal genetic analysis” (http://www.musicfromthegenome.org.uk). The project essentially sings the language of the human genome, with each singer giving voice to their biological identity.*

Listening to “Allele,” a mix of individual voice, choir, and repetition can be heard, similar to the six voices presented in Cloud Atlas. In Mitchell’s novel, each of the narratives has its own individual voice—a unique DNA sequence—yet they are all interconnected not only through reading one another’s stories, but also arguably on a biological level, through shared memories and birthmarks. Furthermore, the title of the novel echoes Frobisher’s Cloud Atlas Sextet, connecting it to a grand composition of six musical voices. Cloud Atlas seems to be a musical project similar to “Allele,” where six separate voices—and with them six separate biological lives—are mixed together and interwoven into a single composition and choir. Their connection exhibits the transcendence of conventional boundaries that Frobisher privileges in his own musical composition; they blur the boundary between individual voices in coming together in a single composition, while also arguably blurring the boundary between individual genetic sequences in their repetitions of one another—think of the comet-shaped birthmark and the stories and memories of their past lives that each experiences.

-W. Smeele

* The audio track “Allele” is well worth a listen (here is the link to the website’s audio player: http://www.musicfromthegenome.org.uk/audioplayer.html)

Advertisements

Tagged: , , , , , , ,

§ 2 Responses to Music from the Genome: Cloud Atlas as Biological Symphony

  • amlehr says:

    Monday, 16 March. Appropriately for a novel named for celestial sextet, David Mitchell’s Cloud Atlas enacts a kind of music of the spheres ─ in multiple senses. Its immense scope and fragmented narratives propel us through time and space, but,

    W. Smeele, I am very intrigued by the way in which you identify the musical motifs of Cloud Atlas with the biological “music” of the human genome. My main question in response

    To riff on Frobisher’s quotation that “[a]ll boundaries are conventions. . . One may transcend any convention”: if the novel’s structure may be compared to forms as codified as musical notation or DNA base pairing,

    On shared textual genetic material: “My favorite word in the world in also one of my favorite writing techniques: ‘metalepsis,’ which allows characters to reappear and embed themselves in other books and other lives. If I have vacancies in a new book, I’ll let other characters whom I already have on file show up at the unemployment office first and reapply. If they can fit

    Our DNA is made of mirrors like inverted melodies: ATCGATTGAGCTCTAGCGTAGCTAACTCGAGATCGC

    As far as musical or genetic metaphors apply, Cloud Atlas makes us ask what it means to “sequence” a novel. Since both the human genome and any music more complex than a melody line operate(s) on principles of simultaneity, is prose (with its distinct sense of temporality that accompanies the demands of reading) capable of reproducing a similar effect? Or is there a sense in which all prose narratives can be understood as “linear”?

    TAGCTAAC TCGAGATCGCATCGATTGAGCTCTAGCG:
    ƨɘibolɘm bɘƚɿɘvni ɘʞil ƨɿoɿɿim ʇo ɘbɒm ƨi AИᗡ ɿuO

    I give them precedence over some new guys who just walk in off the street. How do I know when a book is finished? You’re done with a book when rewrite 13 turns rewrite 12 back into rewrite 11” ─ David Mitchell, The Powerhouse Arena, NYC, October 15, 2012

    does Cloud Atlas “transcend” convention if it depends, in some ways, on appropriating and changing novelistic conventions to make its singularity legible?

    would be: would we consider the novel’s narrative structure as a mutation or as a “normal” double helix, unzipped down the middle?

    over halfway through the text, it becomes clear that the novel’s characters ─ like the comets that mark their bodies ─ travel in orbits that make us end where we began.

    -AML

    • Thank you W. Smeele and AML for your interesting and thought-provoking insights on the ways David Mitchell plays with musical composition throughout Cloud Atlas. As part of my research project this semester, I’ve been thinking a lot about the connections between music and language, but I was having trouble reconciling Mitchell’s pervasive use of musical allusions and metaphors throughout this novel. Both of you offer insights about his innovative use of music that I find compelling.

      WS- I’m very interested in the project Music from the Genome and am excited to look at it more closely when I have more time. I know that from the perspective of neuroscience, they have identified a gene that they think is linked to a human’s level of innate musical ability, (They’ve done this by examining the genome of people who have been diagnosed as “tone deaf.”) but they continue to debate about whether or not music can be deemed a biological adaptation of the human species. From your description, the Music from the Genome project seems to be a really unique and metaphoric way to represent the diversity of “biological identity,” but I wonder whether or not the project is also looking more closely at the biological necessity of music to humans?

      AML- I really like your question about sequencing: “Since both the human genome and any music more complex than a melody line operate(s) on principles of simultaneity, is prose (with its distinct sense of temporality that accompanies the demands of reading) capable of reproducing a similar effect? Or is there a sense in which all prose narratives can be understood as ‘linear’?” Here, you’ve identified a fundamental difference between music and language; one that, I think, writers have been trying to overcome for sometime. With music, a listener can jump in at any point and still understand the narrative of the song, and musical compositions depend on that simultaneity. I’m not sure that you can say the same for most novels. Just imagine how difficult it is to produce simultaneous narratives within a novel. It is impossible. The writer must always pause the reader with a phrase like “meanwhile” and take them back in time to replay events that were happening during the course of the narrative they were just reading. To me, Cloud Atlas was a very difficult reading experience, and I wonder if this difficulty stems from the very project that you are define in your post. That is: Is Mitchell trying to mimic the sequencing of a musical composition in the writing of his novel? And if so, does he succeed? Moreover, what does this do to the novel form? Is this type of narrative possible in the form of the novel, or do we need some other form to accomplish this sort of project? Perhaps this novel would make more sense in an electronic format, one which would allow the reader to jump through the novel and NOT read it linearly?

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

What’s this?

You are currently reading Music from the Genome: Cloud Atlas as Biological Symphony at Bioculture Seminars.

meta